View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_56 (Length: 373)
Name: NF19927_low_56
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 17 - 363
Target Start/End: Complemental strand, 188173 - 187827
Alignment:
| Q |
17 |
aaaggaactcagggaccatgccgatgctaacattgttatcatgttaattggcaacaaaaccgatctcaagcatctccgtgctgttgccactgaggatgcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
188173 |
aaaggaactcagggaccatgccgatgctaacattgttatcatgttaattggcaacaaaaccgatctcaagcatctccgtgctgttgccactgaggatgcc |
188074 |
T |
|
| Q |
117 |
cagagctatgctgaaaaggaaggtctttctttcattgagacatctgctcttgaagccaccaacgtcgagaaggcttttcagacaacccttggagagattt |
216 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
188073 |
cagagctatgctgaaaaggaaggcctttctttcattgagacatctgctcttgaagccaccaacgtcgagaaggcttttcagacaacccttggagagattt |
187974 |
T |
|
| Q |
217 |
accgcataatcagcaagaagtccttgtctaccgccaatgaacctgctgcttctgccaatattaaagaaggcaagaccatcgccattgggggatccgaaac |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
187973 |
accgcataatcagcaagaagtccttgtctaccgccaatgaacctgctgctgctgccaatattaaagaaggcaagaccatcgccattgggggatccgaaac |
187874 |
T |
|
| Q |
317 |
caccaatacaaacaagccctgttgtacatcttgaacttaacttcttc |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
187873 |
caccaatacaaacaagccctgttgtacatcttgaacttaacttcttc |
187827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University