View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_61 (Length: 352)
Name: NF19927_low_61
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_61 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 34 - 100
Target Start/End: Complemental strand, 22070929 - 22070858
Alignment:
| Q |
34 |
tatttataaagtatatatgtt-----gttttgacacttaacagttttgaacaaaaattatatccacgtgata |
100 |
Q |
| |
|
||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22070929 |
tatttataaagtatatatgttttgttgttttaacaggtaacagttttgaacaaaaattatatccacgtgata |
22070858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 93 - 131
Target Start/End: Complemental strand, 22070144 - 22070106
Alignment:
| Q |
93 |
acgtgatattaactatatagtataaatcataaactttaa |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22070144 |
acgtgatattaactatatagtataaatcataaactttaa |
22070106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 300 - 337
Target Start/End: Complemental strand, 22069933 - 22069896
Alignment:
| Q |
300 |
caaaatttgaaaactagctgacaatgtggccgcctttg |
337 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22069933 |
caaaatttggaaactagctgacaatgtggccgcctttg |
22069896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 17058779 - 17058822
Alignment:
| Q |
296 |
tgaccaaaatttgaaaactagctgacaatgtggccgcctttgct |
339 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
17058779 |
tgaccaaaatttggaaactagctgacaatgtggtcgcctttgct |
17058822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University