View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_70 (Length: 336)
Name: NF19927_low_70
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 11 - 320
Target Start/End: Complemental strand, 53427179 - 53426868
Alignment:
| Q |
11 |
cagagatgcaaatttttaaaccaaagagatccatccattgcagcatcatctttccatgcgatcaccccaccnnnnnnncttatgtctttagtgttaa--t |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
53427179 |
cagagatgcaaatttttaaaccaaagagatccatccattgcagcatcatctttccatgcgatcaccccacctttttttcttatgtctttagtgttaaact |
53427080 |
T |
 |
| Q |
109 |
tttatttgcttcatagttcatactgttggctgcacttttggaatatttagagagagctgtgttaggcttggacaatatgctgcacatatctcgtgagaaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
53427079 |
tttatttgcttcatagttcatactgttggctgcacttttggaatatttagagagagctgtgttaggcttggacaatatgctgcacatatcttgttagaaa |
53426980 |
T |
 |
| Q |
209 |
atgaaatagtaaatttgtcatttttgtgaacataagctcattagttttggtaaagaatctatatcaggatataaagaaaaaacaaattatgcatgtccaa |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53426979 |
atgaaatagtaaatttgtcatttttgtgaacataagctcattagttttggtaaagaatctatatcaggatttaaagaaaaaacaaattatgcatgtccaa |
53426880 |
T |
 |
| Q |
309 |
atattcacctat |
320 |
Q |
| |
|
|||||||||||| |
|
|
| T |
53426879 |
atattcacctat |
53426868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University