View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_72 (Length: 334)
Name: NF19927_low_72
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_72 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 9e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 18 - 275
Target Start/End: Complemental strand, 8793888 - 8793630
Alignment:
| Q |
18 |
acaaccaaccattatatcgctcttgcaaagtatactctctatgttgctatgtacttaatagattgtttttccnnnnnnntatgttttgattaataagcaa |
117 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8793888 |
acaaacaaccattatatggctcttgcaaagtatactctctatgttgctatgtacttaatagattgtttttccaaaaaaatatgttttgattaataagcaa |
8793789 |
T |
|
| Q |
118 |
attttaaacatatactcctgtctttaaataattataaagtaattgatagagaaagagtataactgat-nnnnnnntattgtatataaaaaatcatgttga |
216 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
8793788 |
attttaaacatatactcttgtcttttaataattataaagtaattgatagagaaagagtataactgataaaaaaaatattatatataaaaaatcatgttga |
8793689 |
T |
|
| Q |
217 |
gagatatcgacctcttaaatgcatctcaatttatttagtactatgatgttaagaatgga |
275 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8793688 |
gagatatcgacctcttaaatgtatctcaatttatttagtactatgatgttaagagtgga |
8793630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University