View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_73 (Length: 333)
Name: NF19927_low_73
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_73 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 12 - 205
Target Start/End: Complemental strand, 31611830 - 31611637
Alignment:
| Q |
12 |
caacctatcttagaatacaatctagagggaagatgagccacttatagaataaacaagggctcccccagtcttttagctaattgtcattgtcacgacaaac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31611830 |
caacctatcttagaatacaatctagagggaagatgagccactcatagaataaacaagggctcccccagtcttttagctaattgtcattgccacgacaaac |
31611731 |
T |
|
| Q |
112 |
ctttgatcaaatccaaaacatctccatggataccatcttcgaagcaaaaatgagatccttcctcactttttaaatggactacaaaaccgcatgc |
205 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31611730 |
ctttgatcaaatccaacacatctccacggataccatctttgaagcaaaaatgagatcgttccttactttttaaatggactacaaaaccgcatgc |
31611637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University