View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_77 (Length: 330)
Name: NF19927_low_77
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_77 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 30 - 316
Target Start/End: Original strand, 2223945 - 2224231
Alignment:
| Q |
30 |
catatgcaggggatcactgcatgaagccatttgtgatatctcaaccagagatcaatgtatacggacgaacaaaatcagatgagtttgtagtggtggcaag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2223945 |
catatgcaggggatcactgcatgaagccatttgtgatatctcaaccagagatcaatgtatacggacgaacaaaatcagatgagtttgtagtggtggcaag |
2224044 |
T |
|
| Q |
130 |
tgatggtctttgggatgtagtatcaaataattttgtttgtgaagttgttagaagttgccttcaaggtcatatgaggaggcataatatgaaagaagttcac |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2224045 |
tgatggtctttgggatgtagtatcaaataattttgtttgtgaagttgttagaagttgccttcaaggtcatatgaggaggcataatatgaaagaagatcac |
2224144 |
T |
|
| Q |
230 |
aatcacactattaaaagttatgcagcagaggctgctgcaaccttagctgaattggctatggctaagggaagcaaagacaacataagt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2224145 |
aatcacactattaaaagttatgcagcagaggctgctgcaatcttagctgaattggctatggctaagggaagcaaagacaacataagt |
2224231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University