View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_82 (Length: 319)
Name: NF19927_low_82
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_82 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 8e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 9 - 188
Target Start/End: Complemental strand, 8951365 - 8951186
Alignment:
| Q |
9 |
ataattctcaaagcaaggtggttgatgtgcacataaggaacattagtacataaagggccgaaggaagtcaagtgactataccagaaggaagagtttctag |
108 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8951365 |
ataattctcaaagcaaggtcgttgatgtgcacataaggaacattagtacataaagggccgaaggaagtcaagtgactataccagaaggaagagtttctag |
8951266 |
T |
 |
| Q |
109 |
agcttccttaccgagtgaagccatctttaaggatgtttttggctttaatgataaaacccaaagttttggtgttggcatga |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8951265 |
agcttccttaccgagtgaagccatctttaaggatgtttttggctttaatgataaaacccaaagttttggtgttggcatga |
8951186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 186 - 303
Target Start/End: Complemental strand, 8951119 - 8951000
Alignment:
| Q |
186 |
tgaagcatgtcccaaacatgctttcccacaagagaagtcttatcatctcatatcatgtgaattcctagac--caccccaaattttgggtccaacaatttt |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |||||| |||||||||||||||||| ||||||||| |
|
|
| T |
8951119 |
tgaagcatgtcccaaacatgctttcccacaagagaagtcttatcatctcatgtcatctgaatttctagaccacaccccaaattttgggtctaacaatttt |
8951020 |
T |
 |
| Q |
284 |
tacccaactcaccaagttaa |
303 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
8951019 |
tacccaactcaccaagttaa |
8951000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University