View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_83 (Length: 310)
Name: NF19927_low_83
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_83 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 16 - 295
Target Start/End: Original strand, 3570276 - 3570559
Alignment:
| Q |
16 |
atgaatgtgaatggttatcatgcaagctatatatcaacactttgtcaattataatgaattaccaaactattgtgtaattgattcttcataaatt----aa |
111 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3570276 |
atgaatgtgaacggtgatcatgcaagctatatatcaacactttgtcaattataatgaattaccaaactattgtgtaattgattcttcataaattaattaa |
3570375 |
T |
 |
| Q |
112 |
gtgaatgaaatgaatggtttctttgttttttctttccctcacgttgtcttctaaaaccacttatgaattcgaaactaacaaaataaagtaacatcatatt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3570376 |
gtgaatgaaatgaatggtttctttgttttttgtttccctcacgttgtcttctaaaaccacttatgaattcgaaactaacaaaataaagtaacatcatatt |
3570475 |
T |
 |
| Q |
212 |
gtgggttccatgtttggcaatcaccccagatataaatcttaataaggtggaatttgcaatgcactccatagttggtgttgatat |
295 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3570476 |
gtgggttccatgtttggcaatcacccaagatataaatcttaataaggtggaatttgcaatgcactccatagttggtgttgatat |
3570559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University