View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_95 (Length: 291)
Name: NF19927_low_95
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_95 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 33092463 - 33092735
Alignment:
| Q |
1 |
caaacatgccctgaaaaagaatgacaacgagttcatcccaaaaaagaaaggcagaagactttgatgatttactaccagaagattgttgggaatttgtatt |
100 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33092463 |
caaacatgctctaaaaaagaatgacaacgagttcatcccaaaaaagaaaggcagaagactttgatgatttactaccagaagattgttgggaatttgtatt |
33092562 |
T |
 |
| Q |
101 |
atcaaaactcctcaagatcgataacatcgaccaccgtaaccgttatataaggcagactctatcctttgtctccaaaaggttctatccaccagcggttgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33092563 |
atcaaaactcctcaagatcgataacatcgaccaccgtaaccgttatataaggcagactgtatcctttgtctccaaaaggttctatccaccagcggttgtt |
33092662 |
T |
 |
| Q |
201 |
tagtatattctctaacaatcttgaatccatcagtatgcctcactcgcattttccacagattcccatacctaac |
273 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33092663 |
aagtatattctctcacaatcttgaatccatcagtatgcctcactcgcattttccacagattcccatacctaac |
33092735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University