View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_96 (Length: 290)
Name: NF19927_low_96
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_96 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 12 - 219
Target Start/End: Original strand, 9084122 - 9084329
Alignment:
| Q |
12 |
aactgaactttgcgatgatggttttgcttcaaacaaagcagcacgaaactgtgaattcaataaggttaatcttcttgatttgaatgaaggtgatgaggtg |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9084122 |
aactgaactttgtgatgatggttttgcttcaaccaaagcagcacgaaactgtgaattcaataaggttaatcttcttgatttgaatgaaggtgatgaagtg |
9084221 |
T |
 |
| Q |
112 |
agatttgaaatgggaattgaaccatgaatccatgaagaaatgggttgttgagatatggtggaaaatggtaacatagctaccattgtagcatgaatagttg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
9084222 |
agatttgaaatgggaattgaaccatgaatccatggagaaatgggttgttgagttatggtggaagaaggtaacatagctaccattgtagcatgaatagttg |
9084321 |
T |
 |
| Q |
212 |
gttccttc |
219 |
Q |
| |
|
|||||||| |
|
|
| T |
9084322 |
gttccttc |
9084329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University