View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19927_low_98 (Length: 287)
Name: NF19927_low_98
Description: NF19927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19927_low_98 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 3190675 - 3190539
Alignment:
| Q |
1 |
gatcaatatataatagagtaaactctcattttgattcctaaacttgtacgtgttgttacaatattgattcttgaatttagacgactggatattttagaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3190675 |
gatcaatatataatagagtaaactctcattttgattcctaaacttgtatgtgttgttacaatattgattcttgaatttagacgaatggatattttagaag |
3190576 |
T |
|
| Q |
101 |
tagataattgaagacgagagcataagatcaattcgtg |
137 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3190575 |
tagataattgaagacgagagcatatgatcaattcgtg |
3190539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 208 - 261
Target Start/End: Complemental strand, 3190468 - 3190415
Alignment:
| Q |
208 |
tctcaagaataaatgtagtactgtaattttctttgacgtaagattgttataata |
261 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3190468 |
tctcaagaataaatgtaatactgtaattttctttgacgtgagattgttataata |
3190415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University