View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19928_high_13 (Length: 317)
Name: NF19928_high_13
Description: NF19928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19928_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 18 - 290
Target Start/End: Original strand, 43905392 - 43905664
Alignment:
| Q |
18 |
ggagcaaacacattatcgattgccaattgtcgaatttcataatcccattgttcgtggtctttttctttcatttataaaaatgtttaacagaaacttgggg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43905392 |
ggagcaaacacattatcgattgccaattgtcgaatttcataatcccattgttcgtggtctttttctttcatttataaaaatgtttaacagaaacttgggg |
43905491 |
T |
|
| Q |
118 |
cagtttttgatgctacacatcttattcttgcttttaatggcaaaacataagaatatactagtggtatataattgcatgcaaatacattttatttatttca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43905492 |
cagtttttgatgctacacatcttattcttgcttttaatgccaaaacataagaatatactagtggtatataattgcatgcaaatacattttatttatttca |
43905591 |
T |
|
| Q |
218 |
ctttactgtgactcttgaaaaagacactgaaaatggacattatcaaaggtttaacaaaaaataatatctccct |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43905592 |
ctttactgtgactcttgaaaaagacactgaaaatggacattatcaaaggtttaacaaaaaataatatctccct |
43905664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University