View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19928_high_20 (Length: 236)
Name: NF19928_high_20
Description: NF19928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19928_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 116 - 223
Target Start/End: Complemental strand, 30650122 - 30650015
Alignment:
| Q |
116 |
tatacagtttaactaatttaaatcttacatgaataataataccataataacaatagacttatgacctatatacgatagttgaaggctattagctaatccc |
215 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30650122 |
tatacagttttactaatttaaatcgtacatgaataataataccataataccaatagacttatgacctacatacgatagttgaaggctattagctaatccc |
30650023 |
T |
 |
| Q |
216 |
ttgatatt |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
30650022 |
ttgatatt |
30650015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 16 - 87
Target Start/End: Complemental strand, 30650222 - 30650151
Alignment:
| Q |
16 |
acatcattatatgactcttgtcctaataaaaatagattcgatatcatattggttttgcactgctaatgagac |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30650222 |
acatcattatatgactcttgtcctaataaaaatagattcgatatcatattggttttgcactgctaatgagac |
30650151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University