View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19928_high_21 (Length: 228)
Name: NF19928_high_21
Description: NF19928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19928_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 43905914 - 43905801
Alignment:
| Q |
1 |
ggtaaaaaattatagaccaaaaaagtatgttaaaattcaagaacggaggtgtgatatggattgattttatttttgccaataataatagatcaaatagatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43905914 |
ggtaaaaaattatagaccaaaaaagtatgttaaaattcaagaacggaggtgtgatatggattgattttatttttgccaataataatagatcaaatagatt |
43905815 |
T |
|
| Q |
101 |
attaagcaactatt |
114 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
43905814 |
attaagcaagtatt |
43905801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 148 - 228
Target Start/End: Complemental strand, 43905767 - 43905687
Alignment:
| Q |
148 |
cgcaattaggattatgtggttttcttttattttacgtttctactttagaaaatatactcttcatcttccttatccattcat |
228 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43905767 |
cgcaattaggattatgtggtttccttttattttacgtttctactttagaaaatatactcttcatcttccttatccattcat |
43905687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University