View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19928_low_18 (Length: 242)
Name: NF19928_low_18
Description: NF19928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19928_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 44724197 - 44724079
Alignment:
| Q |
1 |
tggaggctttttggattccaaacatgaattaaaatcctatcaatttctaaaaagaaatagaaagatcgaattataagagaaatagacaaaagtaaaattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
44724197 |
tggaggctttttggattccaaacatgaattaaaatcctatcaatttctaaaaagaaatagaaagatcgaattataagagaaatagacaaaagtaaaaatt |
44724098 |
T |
 |
| Q |
101 |
ttagaagatctactctttt |
119 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
44724097 |
ttagaagatctactttttt |
44724079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 126 - 227
Target Start/End: Complemental strand, 44724041 - 44723940
Alignment:
| Q |
126 |
acatgtatctatttctctcgtaaactcagtgtttcatttctttgagaaatagaggaaatatgacaatccaaatatgcctctatgactaaattacgagggt |
225 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44724041 |
acatgtatctatttctctcataaactcagtgtttcatttctttgagaaatagaggaaatatgacaatccaaatatgcatctatgactaaattacgagggt |
44723942 |
T |
 |
| Q |
226 |
tt |
227 |
Q |
| |
|
|| |
|
|
| T |
44723941 |
tt |
44723940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University