View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19928_low_19 (Length: 237)
Name: NF19928_low_19
Description: NF19928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19928_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 28415708 - 28415496
Alignment:
| Q |
1 |
attgttaaaaaatagtactttcagagcagaattagaaaaataaggtaattggctagtctccatgatattggggcattgtattcgtgttgaagattttccc |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28415708 |
attgttaaaaaa-agtactttcagagcagaattagaaaaataaggtaattggctagtcttcatgatattggggcattgtattcgtgttgaagattttcct |
28415610 |
T |
 |
| Q |
101 |
ttatagtctttgtttttgcctttagctcaagaatttagttttagtacatttcgctctcaacattgcacgagagactatagttaactactaatttagagga |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28415609 |
ttatagttgttgtttttgcctttagctcaagaatttagttttagtacatttcgctctcaacattgc-cgagagactatagttaactactaatttagagga |
28415511 |
T |
 |
| Q |
201 |
aggggttttagttgg |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
28415510 |
aggggttttagttgg |
28415496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University