View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_high_104 (Length: 234)
Name: NF19929_high_104
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_high_104 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 9 - 234
Target Start/End: Original strand, 10253814 - 10254048
Alignment:
| Q |
9 |
agcagagaaccagtttccccaaatccatctaaacaaaacatatgcttcaaattattgtggccctgttgactcaaatggacagtgtaaccgtcacagttgc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10253814 |
agcagagaaccagtttccccaaatccatctagacaaaacatatgcttcaaattattgtggccctgttgactcaaatggactgtgtaaccgtcacagttgc |
10253913 |
T |
 |
| Q |
109 |
aatcaatactcttgaggataaactttgaaggatagagattaatttggtcatgaatatataacttgagccgtctaatataac---------ataatgcaga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10253914 |
aatcaatactcttgaggataaactttgaaggatagagattaatttggtcatgaatatataacttgagccgtctaatataacataatattaataatgcaga |
10254013 |
T |
 |
| Q |
200 |
ttactccaactatatgaccgcaggaatatttgtat |
234 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
10254014 |
ttactccaaccatatgaccgcaggaatatttgtat |
10254048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University