View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_high_15 (Length: 591)
Name: NF19929_high_15
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 309; Significance: 1e-174; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 19 - 343
Target Start/End: Complemental strand, 10930326 - 10930002
Alignment:
| Q |
19 |
gttagggtttcgaggaccggtggcggcgatggaggaggaagtgatgtatgtggtggatgaagctaaaggtattcttagtagatacaactcagaagatgat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10930326 |
gttagggtttcgaggaccggtggcggcgatggaggaggaagtgatgtatgtggtggatgaagctaaaggtattcttagtagatacaattcagaagatgat |
10930227 |
T |
 |
| Q |
119 |
attttggaaaagatttttgagtctcaaagactcaaaggagctgaacaaatggttgcaaaacaaggtagaatttgtgttgtatccaccgccgggatatctg |
218 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10930226 |
atttgggaaaagatttttgagtctcaaagactcaaaggagctgaacaaatggttgcaaaacaaggtagaatttgtgttgtttccaccgccgggatatctg |
10930127 |
T |
 |
| Q |
219 |
tggtggatgtagtggcggcgccgcctagaatttcggtggttgagttgccggaagggtttgaagcagtggctgttcatgtcttgccaaggatgccggtaac |
318 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10930126 |
tggtggatgtagtggcggtgccgcctagaatttcggtggttgagttgccggaagggtttgaagcagtggctgttcatgtcttgccaaggatgccggtaac |
10930027 |
T |
 |
| Q |
319 |
tgagtgaattattttgtttttgtat |
343 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
10930026 |
tgagtgaattattttgtttttgtat |
10930002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 125; E-Value: 4e-64
Query Start/End: Original strand, 416 - 544
Target Start/End: Complemental strand, 10929911 - 10929783
Alignment:
| Q |
416 |
gtatttttagttgtacttgagttggaatagtcgttttatttgtttaatggtttatgggatgagctgacattagatatttgaaatgaaagctgaaagtgaa |
515 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10929911 |
gtatttttagttgtacttgagttggaatagtcgttttatttgtttaatagtttatgggatgagctgacattagatatttgaaatgaaagctgaaagtgaa |
10929812 |
T |
 |
| Q |
516 |
aatttgtctgtaatgtataggagaagaaa |
544 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10929811 |
aatttgtctgtaatgtataggagaagaaa |
10929783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University