View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_high_27 (Length: 472)
Name: NF19929_high_27
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 441; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 441; E-Value: 0
Query Start/End: Original strand, 20 - 464
Target Start/End: Complemental strand, 45713981 - 45713537
Alignment:
| Q |
20 |
gaggattgagacaatgaatctaagttgcaattgctttgatggaaacttgccatggtctttaggaaatctttcctacttgacgattttggatcttcaccga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45713981 |
gaggattgagacaatgaatctaagttgcaattgctttgatggaaacttgccatggtctttaggaaatctttcctacttgacgattttggatcttcaccga |
45713882 |
T |
 |
| Q |
120 |
aatctgttgactggagagattcctttggaccttgggaatctaatacaacttgtttattttgatgtttcaggcaatcaattatctggaaagattccagaga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45713881 |
aatctgttgactggagagattcctttggaccttgggaatctaatacaacttgtttattttgatgtttcaggcaatcaattatctggaaagattccagaga |
45713782 |
T |
 |
| Q |
220 |
agttatgcagcctagttaatctaaattaccttgatttctctcaaaacagattggaagggcctattccaataactggtatttgccaaaacctatccgaagt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45713781 |
agttatgcagcctagttaatctaaattaccttgatttctctcaaaacagattggaagggcctattccaataactggtatttgccaaaacctatccgaagt |
45713682 |
T |
 |
| Q |
320 |
tagatttttgggaaacagaaacctttgtgggcagatgttgggtacaaattgtgaggtcaaaagcattggtagatattcattgtttaatgtatggaggctt |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45713681 |
tagatttttgggaaacagaaacctttgtgggcagatgttgggtacaaattgtgaggtcaaaagcattggtagatattcattgtttaatgtatggaggctt |
45713582 |
T |
 |
| Q |
420 |
ggtggaattgccatcgcagtcatattagtaaccttgacctttgct |
464 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45713581 |
ggtggaattgccatcgcagtcatattagtaaccttgatctttgct |
45713537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University