View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_high_57 (Length: 330)
Name: NF19929_high_57
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_high_57 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 46 - 330
Target Start/End: Complemental strand, 37768704 - 37768420
Alignment:
| Q |
46 |
tactagcctaacaactaattatactaaaatttgcgtataatctcaatttatataaaacaaagatagcaaaacaatgttcatttaaaagactaaccaatat |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37768704 |
tactagcctaacaactaattatactaaaatttgcgtataatctcaatttatataaaacaaagatagcaaaacaatattcatttaaaagactaaccaatat |
37768605 |
T |
 |
| Q |
146 |
gatttgaaacatcacagctttaatcaccttagaaagtgtttgttttggaggatgaccagcaacctgattttgtatcgatttcggagaattttggtccgga |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37768604 |
gatttgaaacatcacagctttaatcaccttagaaagtgtttgttttggaggatgaccagcaacctgattttgtatcgatttcggagaattttggtccaga |
37768505 |
T |
 |
| Q |
246 |
gacatcgaattggttgctgaattttgtgttgcgtgtttacgacgactagtagagggagcagggacagtttcagattcaagcatgt |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37768504 |
gacatcgaattggttgctgaattttgtgttgcgtgtttacgacgactagtagagggagcagggacagtttcagattcaagcatgt |
37768420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University