View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_high_66 (Length: 305)
Name: NF19929_high_66
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_high_66 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 32080688 - 32080387
Alignment:
| Q |
1 |
tgcggatatgatgaagccagcaaagattggggaggaagagggtttgactgaagggattgggaagaactcaaagcctcaattttcacagcaggagctttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32080688 |
tgcggatatgatgaagccagcaaagattggggaggaagagggtttgactgaagggattgggaagaactcaaagcctcaattttcacagcaggagctttct |
32080589 |
T |
 |
| Q |
101 |
tttctttacaagctcattccacaattgctattgctttaaaaaagaagagattggttttaatttgatttggggaacactgatgatagtttaggagctttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32080588 |
tttctttacaagctcattccacaattgctattgctttaaaaaagaagagattggttttaatttgatttggggaacactgatgatagtttaggagctttaa |
32080489 |
T |
 |
| Q |
201 |
tcctctcctattaccttaacacttttattag--acagaagaatttggggacggtaccatgaatgcttaatcatttgtacatatagattttcttcttctca |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32080488 |
tcctctcctattaccttaacacttttattagacacagaagaatttggggacggtaccatgaatgcttaatcatttgtacatatagattttcttcttttca |
32080389 |
T |
 |
| Q |
299 |
ct |
300 |
Q |
| |
|
|| |
|
|
| T |
32080388 |
ct |
32080387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University