View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_high_74 (Length: 292)
Name: NF19929_high_74
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_high_74 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 18 - 281
Target Start/End: Original strand, 33645931 - 33646177
Alignment:
| Q |
18 |
catgtaatatcagcttttgatttatttaacaattgttgatattacacactttacactctcatagcgtgtttggtttagcttttacaaccataggcgcgcg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
33645931 |
catgtaatatcagcttttgatttatttaacaatggttgatattacacactttacactctgatagcatgtttggtttaacttttacaaccataggc----- |
33646025 |
T |
|
| Q |
118 |
tttgcagcacctttatgccgtaaatttatgaagctaaaaatcttagcttctattagacgtgtgtgtctatgaagcatggacgctcctcagattaggcgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| || |
|
|
| T |
33646026 |
----------ctttatgccgtaaatttatgaagctaaaaatcttagcttctattagacgtgt--gtctatgaagcatggacgttcctcagattaggcatt |
33646113 |
T |
|
| Q |
218 |
tccaagtgctcaacatgtgtcgtgcgtgatgtgtccgatgtttgtgtctgtatatgtgcttcat |
281 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33646114 |
tccaggtgctcaacatgtgtcgtgcgtgatgtgtccgatgtttgtgtttgtatatgtgcttcat |
33646177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University