View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_high_75 (Length: 290)
Name: NF19929_high_75
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_high_75 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 10 - 198
Target Start/End: Original strand, 1216723 - 1216911
Alignment:
| Q |
10 |
attatactgtggcaagattacatgaactgattatataacattttataatttgattgtgtgtattattggcctactgtgtaggaccctcagggttcatata |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1216723 |
attagactgtggcaagattacatgaactgattatataacattttaaaattttattgtgtgtattactggcctactgtgtaggaccctcagggttcatata |
1216822 |
T |
|
| Q |
110 |
atatagttttagaatgtaattgggggtttattgtctttttgttccctcaacaactattcatagaaatatctgtcgtagctaggtcttgg |
198 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1216823 |
atatagttttagaatgtagttgggggtttattgtctttttgttccctcaacaactattcatagaaatatctgtcgtagctaggtcttgg |
1216911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 197 - 272
Target Start/End: Original strand, 1216955 - 1217034
Alignment:
| Q |
197 |
ggaagaatttgaacgtgtagaaactcttcgttttcagaataa----attgattttgttggaccagcaaatgaattgactt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
1216955 |
ggaagaatttgaacgtgtagaaactcttcgttttcagaataaattgattgattttattggaccagcaaatgaattgactt |
1217034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University