View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_high_76 (Length: 289)
Name: NF19929_high_76
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_high_76 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 59 - 221
Target Start/End: Complemental strand, 4272565 - 4272403
Alignment:
| Q |
59 |
aaatttcttgtcccacaccatcttgttaaattgactattaggctatctagcttttgtttaccgaaatttctccatgagcccctcatatttgcttataagc |
158 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4272565 |
aaatttcttgtcccacgccatcttgttaaattgactattaggctatctagcttttgtttaccgaaatttctccatgagcccctcatatttgcttataagc |
4272466 |
T |
 |
| Q |
159 |
tcatcaattaatcggaacatgtcttttggtgacagaaatctattgaacttaagttttgatcgc |
221 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4272465 |
tcatcaattaatcggaacatgtcttctggtgacagaaatctattgaacttaagttttgatcgc |
4272403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 4272793 - 4272748
Alignment:
| Q |
1 |
gcattttagccatcccaccggcagtctctcccattaatttggagct |
46 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4272793 |
gcatttgagccatcccaccggcagtctctcccattaatttggagct |
4272748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University