View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_high_80 (Length: 279)
Name: NF19929_high_80
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_high_80 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 46464471 - 46464199
Alignment:
| Q |
1 |
ccagtaatccctctattgttcatgtttgtcctaattcctctatacgaccgagttttcgtcccgcttattcgaagaatcacaggaatcccaactggaatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46464471 |
ccagtaatccctctattgttcatgtttgtcctaattcctctatacgaccgagttttcgtcccgcttattcgaagaatcacaggaatcccaaccggaatcc |
46464372 |
T |
 |
| Q |
101 |
gacaccttcaaagaattggaattggattggttctatcagctatatcaatgttagttgctggttttgtcgaaacacgtcgaaaatctgtagccatagaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46464371 |
gacaccttcaaagaattggaattggattggttctatcagctatatcaatgttagttgctggttttgtcgaaacacgtcgaaaatctgtagccatagaaca |
46464272 |
T |
 |
| Q |
201 |
taatatggtagatagcacggagcctttaccaatgagtgttttttggttgggttttcaatatgatattattgga |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
46464271 |
taatatggtagatagcacggagcctttaccaatgagtgttttttggttgggttttcaatatgctatttttgga |
46464199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University