View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_high_87 (Length: 256)
Name: NF19929_high_87
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_high_87 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 109 - 228
Target Start/End: Complemental strand, 15599925 - 15599806
Alignment:
| Q |
109 |
tatctgttatgcacattttgatcgcttgtaagatccgatctatgtgatgttagttataaatgtaagacttataactactgtaaaatcaaatataagattc |
208 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15599925 |
tatctgttatgcacattttgatcacttttaagatccgatctatgtgatgttagttataaatgtaagacttataactactgtaaaatccaatataagattc |
15599826 |
T |
|
| Q |
209 |
agaagttgcaaccttattta |
228 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
15599825 |
agaagttgcaaccttattta |
15599806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 134 - 179
Target Start/End: Original strand, 16007148 - 16007193
Alignment:
| Q |
134 |
ttgtaagatccgatctatgtgatgttagttataaatgtaagactta |
179 |
Q |
| |
|
|||||||||| ||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
16007148 |
ttgtaagatctgatatatgtgattttagtcataaatgtaagactta |
16007193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University