View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_high_93 (Length: 248)
Name: NF19929_high_93
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_high_93 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 37301962 - 37302209
Alignment:
| Q |
1 |
ttcttacaacaatatcatagattcgaagtacaatcatttatcaataataactaatactcaacgataattttttgcacacacaatatagttatctcttgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37301962 |
ttcttacaacaatatcatagattcgaagtacaatcatttattaataataactaatactcagcgataattttttgcacacacaatatagttatctcttgaa |
37302061 |
T |
 |
| Q |
101 |
gagtgacccttattttagatgctcaaattctaataactcgaatgaactaaatatatttgtaaatacgttttagtacttgaaattgagtatataacattaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
37302062 |
gagtgacccttattttagatgctcaaattctaataactcgaatgaactaaatatatttgcaaatacgttttagtacttgacattgagtgtataacattaa |
37302161 |
T |
 |
| Q |
201 |
aaatcaaagcaatgatttgaacatctttaatgtttcaacactttttaa |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37302162 |
aaatcaaagcaatgatttgaacatctttaacgtttcaacactttttaa |
37302209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University