View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_low_102 (Length: 239)
Name: NF19929_low_102
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_low_102 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 49 - 227
Target Start/End: Original strand, 43180874 - 43181052
Alignment:
| Q |
49 |
ctatgaacaacattcaagatatttctaagttatattatagaaatagagggaatgatagctttttatttacatttttgaggctgaaatttaaatcattaat |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43180874 |
ctatgaacaacattcaagatatttctaagttatattatagaaatagagggaatgatagctttttatttacatttttgaggctgaaatttaaatcattaat |
43180973 |
T |
 |
| Q |
149 |
tagctgaaccacatttagtctcttctcttacaaacattactctttatatgtctaaaaagtaagtatatcttatcctttg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43180974 |
tagctgaaccacatttagtctcttctcttacaaacattactctttatatgtctaaaaaataagtatatcttatcctttg |
43181052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University