View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_low_108 (Length: 231)
Name: NF19929_low_108
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_low_108 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 32080876 - 32080675
Alignment:
| Q |
18 |
gttacatgttattggtctttcgtagtccaannnnnnnaccataattgtgttgaatgtaatgtttttgttactgatttttgctggtttggtcatgatgaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32080876 |
gttacatgttattggtctttcgtagtccaatttttttaccataattgtgttgaatgtaatgtttttgttactgatttttgctggtttggtcatgatgaca |
32080777 |
T |
|
| Q |
118 |
gtaatgttccagaagcggtttacatgcagcacttaatgggaattgatggggtgatagtagattttgtgcaagaaataacagaggcggttgcggatatgat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32080776 |
gtaatgttccagaagcggtttacatgcagcacttaatgggaattgatggggtgatagtagattttgtgcaagaaataacagaggcggttgcggatatgat |
32080677 |
T |
|
| Q |
218 |
ga |
219 |
Q |
| |
|
|| |
|
|
| T |
32080676 |
ga |
32080675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University