View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_low_109 (Length: 231)
Name: NF19929_low_109
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_low_109 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 16 - 128
Target Start/End: Complemental strand, 33354974 - 33354862
Alignment:
| Q |
16 |
attctcaccctctcttattctatctaacatataataacactctattgaaacttatcgccctctcttaacctatatgttttaataattacatctaaatttc |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33354974 |
attctcaccctctcttgttctatctaacatgtaataacactctattgaaacttgtcgccctctcttaacctatatgttttaataattacatctaaatttc |
33354875 |
T |
|
| Q |
116 |
acacgactctata |
128 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33354874 |
acacgactctata |
33354862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University