View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_low_115 (Length: 208)
Name: NF19929_low_115
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_low_115 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 25 - 193
Target Start/End: Complemental strand, 35044804 - 35044636
Alignment:
| Q |
25 |
aaaccctcagctgggttttatttagggttgttgagatgtttaaacttccactatagtggctagtgaacttgctaatttcttccgtgtttaattttgacaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35044804 |
aaaccctcagctgggttttatttagggttgttgagatgtttaaacttccactatagtggctagtgaacttgctaatttcttccgtgtttaattttgacaa |
35044705 |
T |
 |
| Q |
125 |
tatatgtatatacatggttttgtatttgttggcaatttggatatatcatgtaacctgggatgtctgtgc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35044704 |
tatatgtatatacatggttttgtatttgttggcaatttggatatatcatgtaacctgggatgtctgtgc |
35044636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University