View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_low_52 (Length: 359)
Name: NF19929_low_52
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_low_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 11 - 342
Target Start/End: Original strand, 5166035 - 5166366
Alignment:
| Q |
11 |
gatgaagttggaagagaggtctagggtttgaagattggtacagttggagagaaagggagatattgttccacggagagagagattgttgagcgagagtttg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5166035 |
gatgaagttggaagagaggtctagggtttgaagattggtacagttggagagaaagggagagattgttccacggagagagagattgttgagcgagagtttg |
5166134 |
T |
 |
| Q |
111 |
tagattctgccattgttgcagagtattcctttgagagttgaggttgattcattgcagggttttgagaaagtggcttcgttccaattttctaaggatttgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5166135 |
tagattctgccattgttgcagagtattcctttgagagttgaggttgattcattgcagggttttgagaatgtggcttcgttccaattttctaaggatttgt |
5166234 |
T |
 |
| Q |
211 |
ttgggtcttgtagtgatttgtttaaatgggttaaacatgcttcatcgcttggatctgatttaattgatgtgattaatgtaatccaaaacattaatactaa |
310 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5166235 |
ttgggtcttgcagtgatttgtttaaatgggttaaacatgcttcatcgcttggatctgatttaattgatgtgattaatgtaatccacaacattaatactaa |
5166334 |
T |
 |
| Q |
311 |
cttcattaaacatgctacatccatctatttcc |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5166335 |
cttcattaaacatgctacatccatctatttcc |
5166366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University