View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_low_57 (Length: 332)
Name: NF19929_low_57
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_low_57 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 70; Significance: 2e-31; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 109 - 206
Target Start/End: Complemental strand, 39074534 - 39074437
Alignment:
| Q |
109 |
aatgaaacacatactgatgatacaagagttctttccaacacaagaaatacagagaaaaaacaaagagttatttgcaagacacatgccaataccaggaa |
206 |
Q |
| |
|
||||||||| ||| ||||||||||| |||||||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
39074534 |
aatgaaacatatagtgatgatacaaaagttctttccaacaaaagaaatacatagaaaaaacaaaaagttatttgcaagacacatgccaatatcaggaa |
39074437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 201 - 264
Target Start/End: Complemental strand, 39073649 - 39073586
Alignment:
| Q |
201 |
caggaacagcaaaaacctcagctagaaggttattcacaaatatatcaaaggattgactcacaaa |
264 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
39073649 |
caggaacagcaaaaacctcagctagaagattattcacaaatatatcaaaggattgacccacaaa |
39073586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 262 - 318
Target Start/End: Complemental strand, 39073529 - 39073473
Alignment:
| Q |
262 |
aaagatagcaattttacttttacttttacaagcaatagtaaaagtttaccttgaatg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39073529 |
aaagatagcaattttacttttacttttacaagcaatagtaaaagtttaccttaaatg |
39073473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 16 - 86
Target Start/End: Complemental strand, 39074597 - 39074526
Alignment:
| Q |
16 |
atactttatcctttaaaaaatattataacaatggtatattatata-tttctttaacaaaccaaaatgaaaca |
86 |
Q |
| |
|
||||||||||||| |||||||||||||||||| | |||||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
39074597 |
atactttatccttaaaaaaatattataacaatagcatattatatattttttttaacaaactaaaatgaaaca |
39074526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University