View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_low_64 (Length: 314)
Name: NF19929_low_64
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_low_64 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 16 - 314
Target Start/End: Complemental strand, 38583814 - 38583516
Alignment:
| Q |
16 |
ataaccaaagtactaaaatggcacttgatgattgcaaagacttattagaattcgcgattgatgaattagaagcctcgagtattttagctgctgataacag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38583814 |
ataaccaaagtactaaaatggcacttgatgattgcaaagacttattagaattcgcgattgatgaattacaagcctcgagtattttagctgctgataacag |
38583715 |
T |
 |
| Q |
116 |
cagcgttcacaatgttaatgaccgcgctgctgatcttaaaaattggttaggtgctgtttttgcctaccaacaatcatgtcttgacggttttgatacagat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38583714 |
cagcgttcacaatgttaatgaccgcgctgctgaccttaaaaattggttaggtgctgtttttgcctaccaacaatcatgtcttgacggttttgatacagat |
38583615 |
T |
 |
| Q |
216 |
ggcgaaaagcaggttcaatcacaattgcaaacaggtagtttggatcatgtaggaaaacttaccgcgttagcacttgatgttgtgactgcgattacaaaa |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38583614 |
ggcgaaaagcaggttcaatcacaattgcaaacaggtagtttggatcatgtaggaaaacttaccgcgttagcacttgatgttgtgactgcgattacaaaa |
38583516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University