View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_low_73 (Length: 297)
Name: NF19929_low_73
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_low_73 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 279
Target Start/End: Complemental strand, 22588499 - 22588236
Alignment:
| Q |
16 |
attctaagctatgatttttagaccaataggctttctaagattttgtttaggaatgtgctcggttttgccaaacatttgtatttgtatatgaaacaaagca |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22588499 |
attctaagctatgatttcaagaccaataggctttctaagatattgtttaggaatgtgctcggttttgccaaacatttgtatttgtatatgaaacaaagca |
22588400 |
T |
 |
| Q |
116 |
taacaatctatgccaaatttctctaccactagtgtgttcatatttcacaatgggtccaagagttgctgcnnnnnnnntcatcactcataatctttacata |
215 |
Q |
| |
|
||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22588399 |
taataattaatgccaaatttctctaccactagtgtgttcatatttcacaatgggtccaagagttgctgcaaaaaaattcatcactcataatctttacata |
22588300 |
T |
 |
| Q |
216 |
aagttttgctactaatgttcttctaattatcctacgtactaaaactactttaacaactaggatg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22588299 |
aagttttgctactaatgttcttctaattatcctacttactaaaactactttaacaactaggatg |
22588236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University