View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_low_74 (Length: 295)
Name: NF19929_low_74
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_low_74 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 48857586 - 48857325
Alignment:
| Q |
1 |
tcaccgtaagagtgtattgctgcctaggctaagcttaattcaggtgttgttgagggcgagggatcccagattgggtgtaaagnnnnnnntaggttattca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48857586 |
tcaccgtaagagtgtattgctgcctaggctaggcttaattcaggtgttgttgagggcgagggatcccagattgggtgtaaagaaaaaaataggttattca |
48857487 |
T |
 |
| Q |
101 |
tagttcttttagaatcaaggttggaaaacttatcatttgattttaaaatctttgtggtgattatatcaaaccttcatnnnnnnnnnnnnnnnnnnctttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48857486 |
tagttcttttagaatcaaggttggaaaacttatcatttgattttaaaatctttgtggtgattatatcaaaccttcataaaaaataaaaataaaaactttt |
48857387 |
T |
 |
| Q |
201 |
tgtagtgatcattagatcaaaccttcatagaagctgtccatgcttatttttagaaaaggaaa |
262 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48857386 |
tgcagtgatcattagatcaaaccttcatagaagctgtccatgcttatttttagaaaaggaaa |
48857325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University