View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_low_79 (Length: 283)
Name: NF19929_low_79
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_low_79 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 87; Significance: 9e-42; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 130 - 260
Target Start/End: Original strand, 10507427 - 10507558
Alignment:
| Q |
130 |
ctattttaatttttctacaaaccgaagcatactgaagctctatacatttatcatgtcacatacgaggtggtctctggacaatcnnnnnnnggtggtggcc |
229 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10507427 |
ctattttaatttttctacgaaccgaagcatacttaagctctatacatttatcatgtcacatacgaggtggtctctggacaatctttttttggtggtggcc |
10507526 |
T |
 |
| Q |
230 |
gaggtttgaa-tccagaccttgcatatattat |
260 |
Q |
| |
|
|| ||||||| |||||||||||||||||||| |
|
|
| T |
10507527 |
gatgtttgaaccccagaccttgcatatattat |
10507558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 17 - 105
Target Start/End: Original strand, 10507225 - 10507317
Alignment:
| Q |
17 |
agttaggaagctatttctttgtcaagtcacacagacccacac----tatgtaggaaggatatagaaaatactttattttttcttacagaatgc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10507225 |
agttaggaagctatttctttgtcaagtcacacagacccacacatcctatgtaggaaggatatagaaaatactttattttttcttacagaatgc |
10507317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 220 - 260
Target Start/End: Complemental strand, 17151308 - 17151267
Alignment:
| Q |
220 |
ggtggtggccgaggtttgaatcc-agaccttgcatatattat |
260 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
17151308 |
ggtggtggccgaggtttgaaccccagaccttgcatatattat |
17151267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 263
Target Start/End: Complemental strand, 10405121 - 10405082
Alignment:
| Q |
224 |
gtggccgaggtttgaatccagaccttgcatatattattca |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10405121 |
gtggccgaggtttgaatccagaccttgcatatatttttca |
10405082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 260
Target Start/End: Complemental strand, 17704084 - 17704044
Alignment:
| Q |
221 |
gtggtggccgaggtttgaatc-cagaccttgcatatattat |
260 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17704084 |
gtggtggccgaggtttgaatcacagaccttgcatatattat |
17704044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 222 - 260
Target Start/End: Original strand, 44084263 - 44084301
Alignment:
| Q |
222 |
tggtggccgaggtttgaatccagaccttgcatatattat |
260 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
44084263 |
tggtggccgaggtttgaacccggaccttgcatatattat |
44084301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 260
Target Start/End: Complemental strand, 56205014 - 56204978
Alignment:
| Q |
224 |
gtggccgaggtttgaatccagaccttgcatatattat |
260 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
56205014 |
gtggccgaggtttgaatccggaccttgcatatattat |
56204978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 260
Target Start/End: Original strand, 20566735 - 20566771
Alignment:
| Q |
224 |
gtggccgaggtttgaatccagaccttgcatatattat |
260 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| |
|
|
| T |
20566735 |
gtggccgaggtttgaacccggaccttgcatatattat |
20566771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 260
Target Start/End: Complemental strand, 38375028 - 38374988
Alignment:
| Q |
221 |
gtggtggccgaggtttgaa-tccagaccttgcatatattat |
260 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
38375028 |
gtggtggccggggtttgaactccagaccttgcatatattat |
38374988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 220 - 260
Target Start/End: Original strand, 42045361 - 42045402
Alignment:
| Q |
220 |
ggtggtggccgaggtttgaa-tccagaccttgcatatattat |
260 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
42045361 |
ggtggtggccggggtttgaactccagaccttgcatatattat |
42045402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 220 - 260
Target Start/End: Complemental strand, 18043502 - 18043462
Alignment:
| Q |
220 |
ggtggtggccgaggtttgaatccagaccttgcatatattat |
260 |
Q |
| |
|
|||||||| || |||||||| |||||||||||||||||||| |
|
|
| T |
18043502 |
ggtggtggtcggggtttgaacccagaccttgcatatattat |
18043462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 260
Target Start/End: Original strand, 16577850 - 16577890
Alignment:
| Q |
221 |
gtggtggccgaggtttgaatcc-agaccttgcatatattat |
260 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
16577850 |
gtggtggccgaggtttgaaccccagaccttgcatatattat |
16577890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 260
Target Start/End: Complemental strand, 16587812 - 16587772
Alignment:
| Q |
221 |
gtggtggccgaggtttgaatcc-agaccttgcatatattat |
260 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
16587812 |
gtggtggccgaggtttgaaccccagaccttgcatatattat |
16587772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 220 - 260
Target Start/End: Complemental strand, 11720965 - 11720925
Alignment:
| Q |
220 |
ggtggtggccgaggtttgaatccagaccttgcatatattat |
260 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
11720965 |
ggtggtggccggggtttgaaccccgaccttgcatatattat |
11720925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 260
Target Start/End: Original strand, 35863803 - 35863843
Alignment:
| Q |
221 |
gtggtggccgaggtttgaatcc-agaccttgcatatattat |
260 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
35863803 |
gtggtggccgaggtttgaaccccagaccttgcatatattat |
35863843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 260
Target Start/End: Original strand, 15447704 - 15447744
Alignment:
| Q |
221 |
gtggtggccgaggtttgaa-tccagaccttgcatatattat |
260 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
15447704 |
gtggtggccggggtttgaactccagaccttgcatatattat |
15447744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University