View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_low_80 (Length: 282)
Name: NF19929_low_80
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_low_80 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 9 - 269
Target Start/End: Original strand, 7243053 - 7243322
Alignment:
| Q |
9 |
agatgaaccatcatcttcttcctactctctcttctttgttacttggnnnnnnnnnnnnngttacatatagatagttcgcatgaaagtgattagtgtgtgt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7243053 |
agatgaaccatcatcttcttcctactctctcttctttgttacttggaaaaaggaaaaa-gttacatatagatagttcgcatgaaagtgattagtgtgtgt |
7243151 |
T |
|
| Q |
109 |
cagcatgcacaggcatcttatgtcaattggaatcctctctggtgccaaagcagagagtatcattttggagatagaaacttttttcttaacatatgtattt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7243152 |
cagcatgcacaggcatcttatgtcaattggaatcctctctggtgccaaagcagagagtatcattttggagatagaaacttttttcttaagatatgtattt |
7243251 |
T |
|
| Q |
209 |
tattctctacaaggacaccctcta----------ttagaaagaatataattgcaaattaggagtgaaaaat |
269 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7243252 |
tattctctagaaggacaccctctattggagtaacttagaaagaatataattgcaaattaggagtgaaaaat |
7243322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University