View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_low_83 (Length: 273)
Name: NF19929_low_83
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_low_83 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 31 - 242
Target Start/End: Original strand, 40342858 - 40343069
Alignment:
| Q |
31 |
catgattttgtcatactcaatagtaagtatcaatctaaacatacattaattgttactgtactatctagcatttccattatataaatatgcccttcagcaa |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40342858 |
catgattttgtcatactcaatagtaagtatcaatctaaacatacactaattgttactgtactatctagcatttccattatataaatatgtccttcagcaa |
40342957 |
T |
|
| Q |
131 |
tgacaccatttgatttcaatttgacactatagggagatgcataacatgtcaatcgctatctgagacttggtttacattacgggcaccaaaaaatcactag |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40342958 |
tgacaccatttgatttcaatttgacactatagggagatgcataacatgtcaatcgctatctgagacttggtttacattacgggcaccaaaaaatcactag |
40343057 |
T |
|
| Q |
231 |
ttacttagatga |
242 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40343058 |
ttacttagatga |
40343069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University