View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_low_91 (Length: 249)
Name: NF19929_low_91
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_low_91 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 1517031 - 1517271
Alignment:
| Q |
1 |
atggtcttcatcagcatcaaatctctaattaatgcgttcaagatgatgtagaaagaaaggcaaattgtattgttcttctaagagcaatgctatttacatt |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1517031 |
atggtcttcatcggcatcaaatctctaattaatgcgttcaagatgatgtagaaagaaaggcaaattgtattgttcttctaagagcaatgctatttacatt |
1517130 |
T |
 |
| Q |
101 |
atttatcacaaaatctatttatacaaaacatgcataactcgttattttttctggaagatgcttgatag----atttctagagagggctaatgtatatgag |
196 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
1517131 |
atttatcacaaaatctattgatacaaaacatgcataagtcgttgttttttctggaagatgcttgatagattaatttcaagagagggctaatgtatatgag |
1517230 |
T |
 |
| Q |
197 |
aaattttatggttctgtgaagaaaaagaaaaatgggatatt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1517231 |
aaattttatggttctgtgaagaaaaagaaaaatgggatatt |
1517271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University