View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19929_low_98 (Length: 242)
Name: NF19929_low_98
Description: NF19929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19929_low_98 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 104 - 161
Target Start/End: Original strand, 10066856 - 10066913
Alignment:
| Q |
104 |
tctcaattatctcgtgatattattttttatacgtctaaaatattttagtttactctat |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10066856 |
tctcaattatctcgtgatattattttttatacgtctaaaatattttagtttactctat |
10066913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 165 - 233
Target Start/End: Original strand, 10066946 - 10067014
Alignment:
| Q |
165 |
ttgtagcatgtaacttgtgtggcttcactttgatatattcaaatagtaaatactaatataagtataatc |
233 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
10066946 |
ttgtagcatgtaacttgtgtggctttactttgatacattcaaatagtaaatactaatataagtaaaatc |
10067014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 170 - 225
Target Start/End: Original strand, 10061060 - 10061115
Alignment:
| Q |
170 |
gcatgtaacttgtgtggcttcactttgatatattcaaatagtaaatactaatataa |
225 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10061060 |
gcatgtaacttgtgtagcttcactttgatatattcaaatagtaaagactaatataa |
10061115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 45
Target Start/End: Original strand, 10066724 - 10066752
Alignment:
| Q |
17 |
aggatttgaaaaatctctaatacacacat |
45 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10066724 |
aggatttgaaaaatctctaatacacacat |
10066752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University