View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1992_high_5 (Length: 337)
Name: NF1992_high_5
Description: NF1992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1992_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 18 - 334
Target Start/End: Original strand, 43410651 - 43410967
Alignment:
| Q |
18 |
ctttcagagtgaaggcaactttcgcggatgaaaaaatcaggtttagcttgcaagcaatgtggggatttagagatttgcagcttgagattgcaaggcgatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410651 |
ctttcagagtgaaggcaactttcgcggatgaaaaaatcaggtttagcttgcaagcaatgtggggatttagagatttgcagcttgagattgcaaggcgatt |
43410750 |
T |
 |
| Q |
118 |
taacctaacagatatgaacaacttggttctaaaatatttggatgatgaaggagaatgggttgtgttatcatgtgatgctgatcttgaagaatgtaaagac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410751 |
taacctaacagatatgaacaacttggttctaaaatatttggatgatgaaggagaatgggttgtgttatcatgtgatgctgatcttgaagaatgtaaagac |
43410850 |
T |
 |
| Q |
218 |
ttgcacacatcatctcacacacgtaccattagactctctctttttcaagcttcccctctcaatattccaaacactttccgcaacagcagcagcagcagtc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410851 |
ttgcacacatcatctcacacacgtaccattagactctctctttttcaagcttcccctctcaatcttccaaacactttccgcaacagcagcagcagcagtc |
43410950 |
T |
 |
| Q |
318 |
catcctcctagctagct |
334 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43410951 |
catcctcctagctagct |
43410967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University