View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1992_high_7 (Length: 215)

Name: NF1992_high_7
Description: NF1992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1992_high_7
NF1992_high_7
[»] chr8 (1 HSPs)
chr8 (17-200)||(34811843-34812027)


Alignment Details
Target: chr8 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 17 - 200
Target Start/End: Original strand, 34811843 - 34812027
Alignment:
17 tgaagttatccatatacacttaaaaattgatcaaaatttcttgtaattaaaatcagcagactagtttcctataaaaataaaaatgattggcaggagtata 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34811843 tgaagttatccatatacacttaaaaattgatcaaaatttcttgtaattaaaatcagcagactagtttcctataaaaataaaaatgattggcaggagtata 34811942  T
117 ttttaaa-atttaannnnnnnnngaaatggcagaggtagtatcaccactacatgtatctagagatactaaacaagtgtgcaaaat 200  Q
    |||||||  |||           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
34811943 ttttaaattttttttttttttttgaaatggcagaggtagtatcaccactacatgtatctagagatactaaacaagtttgcaaaat 34812027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University