View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1992_low_10 (Length: 227)
Name: NF1992_low_10
Description: NF1992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1992_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 26 - 206
Target Start/End: Complemental strand, 43411192 - 43411012
Alignment:
| Q |
26 |
gtttggtatgatgctttgttaactaaaactctaattaaacaatatgatgtgtaattaacaaaataaagccgcagaatctaacttaacgagtaattaaatg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43411192 |
gtttggtatgatgctttgttaactaaaactctaattaaacaacaagatgtgtaattaacaaaataaagccgcagaatctaacttaacgagtaattaaatg |
43411093 |
T |
|
| Q |
126 |
aaaagcagtaaaggtatatgagctaacattgatgttatgtttgcttgggaatttggatgctatacaatatacagacagaca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43411092 |
aaaagcagtaaaggtatatgagctaacattgatgttatgtttgcttgggaatttggatgctatacaatatacagacagaca |
43411012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University