View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1992_low_12 (Length: 215)
Name: NF1992_low_12
Description: NF1992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1992_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 17 - 200
Target Start/End: Original strand, 34811843 - 34812027
Alignment:
| Q |
17 |
tgaagttatccatatacacttaaaaattgatcaaaatttcttgtaattaaaatcagcagactagtttcctataaaaataaaaatgattggcaggagtata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34811843 |
tgaagttatccatatacacttaaaaattgatcaaaatttcttgtaattaaaatcagcagactagtttcctataaaaataaaaatgattggcaggagtata |
34811942 |
T |
 |
| Q |
117 |
ttttaaa-atttaannnnnnnnngaaatggcagaggtagtatcaccactacatgtatctagagatactaaacaagtgtgcaaaat |
200 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34811943 |
ttttaaattttttttttttttttgaaatggcagaggtagtatcaccactacatgtatctagagatactaaacaagtttgcaaaat |
34812027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University