View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19930_high_25 (Length: 289)

Name: NF19930_high_25
Description: NF19930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19930_high_25
NF19930_high_25
[»] chr1 (1 HSPs)
chr1 (67-127)||(28570492-28570552)


Alignment Details
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 67 - 127
Target Start/End: Complemental strand, 28570552 - 28570492
Alignment:
67 ctgcctttgttaatccaaagccgtatgcactcgaattcgatgatggatgatttaaaggtgt 127  Q
    |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
28570552 ctgcttttgttaatccaaagcggtatgcactcgaattcgatgatggatgatttaaaggtgt 28570492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University