View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19930_high_41 (Length: 223)

Name: NF19930_high_41
Description: NF19930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19930_high_41
NF19930_high_41
[»] chr7 (1 HSPs)
chr7 (22-205)||(39036669-39036850)


Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 22 - 205
Target Start/End: Original strand, 39036669 - 39036850
Alignment:
22 atagtagtacgtaccatgcaatataattcagctcccctaaggtagcaatattaatacagagttacatagacnnnnnnngagaatgttttatttaatttca 121  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||       ||||||||||||||||||||||    
39036669 atagtagtacgtaccatgcaatataattcagctcccctaaggtagcaatat--atacagagttacatagacaaaaaaagagaatgttttatttaatttca 39036766  T
122 ctggatacacaacaacgttatgaatttaacaaccagatggagaaagagttatgataacccttatgagtgatggtgtggtgttag 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39036767 ctggatacacaacaacgttatgaatttaacaaccagatggagaaagagttatgataacccttatgagtgatggtgtggtgttag 39036850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University