View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19930_low_23 (Length: 311)

Name: NF19930_low_23
Description: NF19930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19930_low_23
NF19930_low_23
[»] chr5 (1 HSPs)
chr5 (52-294)||(4406857-4407099)


Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 52 - 294
Target Start/End: Complemental strand, 4407099 - 4406857
Alignment:
52 atgcccttccccccacttacgataatgaaatcaaaatcaaatttcaaatcagcataactcaatggacggtgacctggtccccaaataccaacattaagat 151  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
4407099 atgcacttccccccacttacgataatgaaatcaaaatcaaatttcaaatcagcataactcaatggacggtgacctggtccccaaataccaacattgagat 4407000  T
152 tcgtcacggcaatatatttccatacacaccaactaactttcttctttatctttaagtctctacagtaacaaatatgtgcccataactaaattgtctcacc 251  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4406999 tcgtcacggcaatatatttccatacacaccaactaactttcttctttatctttaagtctctacagtaacaaatatgtgcccataactaaattgtctcacc 4406900  T
252 atatgtgactttaccatactaatctttataaacacataaaaag 294  Q
    |||||||||||||||||||||||||||||||||||||||||||    
4406899 atatgtgactttaccatactaatctttataaacacataaaaag 4406857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University