View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19930_low_23 (Length: 311)
Name: NF19930_low_23
Description: NF19930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19930_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 52 - 294
Target Start/End: Complemental strand, 4407099 - 4406857
Alignment:
| Q |
52 |
atgcccttccccccacttacgataatgaaatcaaaatcaaatttcaaatcagcataactcaatggacggtgacctggtccccaaataccaacattaagat |
151 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4407099 |
atgcacttccccccacttacgataatgaaatcaaaatcaaatttcaaatcagcataactcaatggacggtgacctggtccccaaataccaacattgagat |
4407000 |
T |
 |
| Q |
152 |
tcgtcacggcaatatatttccatacacaccaactaactttcttctttatctttaagtctctacagtaacaaatatgtgcccataactaaattgtctcacc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4406999 |
tcgtcacggcaatatatttccatacacaccaactaactttcttctttatctttaagtctctacagtaacaaatatgtgcccataactaaattgtctcacc |
4406900 |
T |
 |
| Q |
252 |
atatgtgactttaccatactaatctttataaacacataaaaag |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4406899 |
atatgtgactttaccatactaatctttataaacacataaaaag |
4406857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University