View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19930_low_28 (Length: 279)
Name: NF19930_low_28
Description: NF19930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19930_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 11 - 261
Target Start/End: Complemental strand, 37769540 - 37769285
Alignment:
| Q |
11 |
cagagaaaagagcaggaaaatttgacatgaacagatgtttcaggtttcttccaatctcagctacctcccaattgggaagaatagataacaacacacgaaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37769540 |
cagagaaaagagcaggaaaatttgacatgaacagatgtttcaggtttcttccaatatcagctacctcccaattgggaagaatagataacaacacacgaaa |
37769441 |
T |
|
| Q |
111 |
cttgtgcccttccacttgtgctaaagaaatttttattcttaggagcaccccttttaactatctttatgatttggttgcgatcgcaattgca-----gctg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
37769440 |
cttgtgcccttccacttgtgctaaagaaatttttattcttaggagcaccccttttaactatctttatgatttggttgtgatcgcaattgcagctacgctg |
37769341 |
T |
|
| Q |
206 |
cgaataaaaggttaggtgagttgggtcccagggttcaccatagccaagcctcatgg |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37769340 |
cgaataaaaggttaggtgagttgggtcccagggttcaccatagccaagcctcatgg |
37769285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University