View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19930_low_31 (Length: 260)
Name: NF19930_low_31
Description: NF19930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19930_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 44083119 - 44083268
Alignment:
| Q |
1 |
aaacatatcgtctttagattttaggtaagagtatgatatatttcctacttgtatgtatgcttttatttgaacgtggatgattctcagggttcacttcgta |
100 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
44083119 |
aaacacatcatctttagattttaggtaagagtatgatatctttcctacttgtatgtatacttttatttgaacgtggatgattctcagagctcacttcgta |
44083218 |
T |
 |
| Q |
101 |
acccaatagtaaactacatattgacaatgtatagataaatgaatgagtta |
150 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44083219 |
acccaataataaactacatattgacaatgtatagataaatgaatgagtta |
44083268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 185
Target Start/End: Original strand, 44083320 - 44083357
Alignment:
| Q |
149 |
tattttaaatcaaaa-ctattttgatcgtgtaattatc |
185 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44083320 |
tattttaaatcaaaaactattttgatcgtgtaattatc |
44083357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University